From fbebfdf23db958e3bb06dc0d4ccadca48d748dff Mon Sep 17 00:00:00 2001
From: ko1 <ko1@b2dd03c8-39d4-4d8f-98ff-823fe69b080e>
Date: Fri, 28 Sep 2007 13:42:36 +0000
Subject: * benchmark/bm_so_fasta.rb: added. * benchmark/bm_so_k_nucleotide.rb:
 added. * benchmark/bm_so_reverse_complement.rb: added. *
 benchmark/make_fasta_output.rb: added. *
 benchmark/prepare_so_k_nucleotide.rb: added. *
 benchmark/prepare_so_reverse_complement.rb: added.

git-svn-id: svn+ssh://ci.ruby-lang.org/ruby/trunk@13550 b2dd03c8-39d4-4d8f-98ff-823fe69b080e
---
 benchmark/bm_so_fasta.rb                   | 81 ++++++++++++++++++++++++++++++
 benchmark/bm_so_k_nucleotide.rb            | 48 ++++++++++++++++++
 benchmark/bm_so_reverse_complement.rb      | 30 +++++++++++
 benchmark/make_fasta_output.rb             | 19 +++++++
 benchmark/prepare_so_k_nucleotide.rb       |  2 +
 benchmark/prepare_so_reverse_complement.rb |  2 +
 6 files changed, 182 insertions(+)
 create mode 100644 benchmark/bm_so_fasta.rb
 create mode 100644 benchmark/bm_so_k_nucleotide.rb
 create mode 100644 benchmark/bm_so_reverse_complement.rb
 create mode 100644 benchmark/make_fasta_output.rb
 create mode 100644 benchmark/prepare_so_k_nucleotide.rb
 create mode 100644 benchmark/prepare_so_reverse_complement.rb

(limited to 'benchmark')

diff --git a/benchmark/bm_so_fasta.rb b/benchmark/bm_so_fasta.rb
new file mode 100644
index 0000000000..b95f5e9f10
--- /dev/null
+++ b/benchmark/bm_so_fasta.rb
@@ -0,0 +1,81 @@
+# The Computer Language Shootout
+# http://shootout.alioth.debian.org/
+# Contributed by Sokolov Yura
+
+$last = 42.0
+def gen_random (max,im=139968,ia=3877,ic=29573)
+    (max * ($last = ($last * ia + ic) % im)) / im
+end
+
+alu =
+   "GGCCGGGCGCGGTGGCTCACGCCTGTAATCCCAGCACTTTGG"+
+   "GAGGCCGAGGCGGGCGGATCACCTGAGGTCAGGAGTTCGAGA"+
+   "CCAGCCTGGCCAACATGGTGAAACCCCGTCTCTACTAAAAAT"+
+   "ACAAAAATTAGCCGGGCGTGGTGGCGCGCGCCTGTAATCCCA"+
+   "GCTACTCGGGAGGCTGAGGCAGGAGAATCGCTTGAACCCGGG"+
+   "AGGCGGAGGTTGCAGTGAGCCGAGATCGCGCCACTGCACTCC"+
+   "AGCCTGGGCGACAGAGCGAGACTCCGTCTCAAAAA"
+
+iub = [
+    ["a", 0.27],
+    ["c", 0.12],
+    ["g", 0.12],
+    ["t", 0.27],
+
+    ["B", 0.02],
+    ["D", 0.02],
+    ["H", 0.02],
+    ["K", 0.02],
+    ["M", 0.02],
+    ["N", 0.02],
+    ["R", 0.02],
+    ["S", 0.02],
+    ["V", 0.02],
+    ["W", 0.02],
+    ["Y", 0.02],
+]
+homosapiens = [
+    ["a", 0.3029549426680],
+    ["c", 0.1979883004921],
+    ["g", 0.1975473066391],
+    ["t", 0.3015094502008],
+]
+
+def make_repeat_fasta(id, desc, src, n)
+    puts ">#{id} #{desc}"
+    v = nil
+    width = 60
+    l = src.length
+    s = src * ((n / l) + 1)
+    s.slice!(n, l)
+    puts(s.scan(/.{1,#{width}}/).join("\n"))
+end
+
+def make_random_fasta(id, desc, table, n)
+    puts ">#{id} #{desc}"
+    rand, v = nil,nil
+    width = 60
+    chunk = 1 * width
+    prob = 0.0
+    table.each{|v| v[1]= (prob += v[1])}
+    for i in 1..(n/width)
+        puts((1..width).collect{
+            rand = gen_random(1.0)
+            table.find{|v| v[1]>rand}[0]
+        }.join)
+    end
+    if n%width != 0
+        puts((1..(n%width)).collect{
+            rand = gen_random(1.0)
+            table.find{|v| v[1]>rand}[0]
+        }.join)
+    end
+end
+
+
+n = (ARGV[0] or 250_000).to_i
+
+make_repeat_fasta('ONE', 'Homo sapiens alu', alu, n*2)
+make_random_fasta('TWO', 'IUB ambiguity codes', iub, n*3)
+make_random_fasta('THREE', 'Homo sapiens frequency', homosapiens, n*5)
+
diff --git a/benchmark/bm_so_k_nucleotide.rb b/benchmark/bm_so_k_nucleotide.rb
new file mode 100644
index 0000000000..c0a5ba5046
--- /dev/null
+++ b/benchmark/bm_so_k_nucleotide.rb
@@ -0,0 +1,48 @@
+# The Computer Language Shootout
+# http://shootout.alioth.debian.org
+#
+# contributed by jose fco. gonzalez
+# modified by Sokolov Yura
+
+seq = String.new
+
+def frecuency( seq,length )
+    n, table = seq.length - length + 1, Hash.new(0)
+    f, i = nil, nil
+    (0 ... length).each do |f|
+        (f ... n).step(length) do |i|
+            table[seq[i,length]] += 1
+        end
+    end
+    [n,table]
+
+end
+
+def sort_by_freq( seq,length )
+    n,table = frecuency( seq,length )
+    a, b, v = nil, nil, nil
+    table.sort{|a,b| b[1] <=> a[1]}.each do |v|
+        puts "%s %.3f" % [v[0].upcase,((v[1]*100).to_f/n)]
+    end
+    puts
+end
+
+def find_seq( seq,s )
+    n,table = frecuency( seq,s.length )
+    puts "#{table[s].to_s}\t#{s.upcase}"
+end
+
+input = open(File.join(File.dirname($0), 'fasta.output.100000'), 'rb')
+
+line = input.gets while line !~ /^>THREE/
+line = input.gets
+
+while (line !~ /^>/) & line do
+    seq << line.chomp
+    line = input.gets
+end
+
+[1,2].each {|i| sort_by_freq( seq,i ) }
+
+%w(ggt ggta ggtatt ggtattttaatt ggtattttaatttatagt).each{|s| find_seq( seq,s) }
+
diff --git a/benchmark/bm_so_reverse_complement.rb b/benchmark/bm_so_reverse_complement.rb
new file mode 100644
index 0000000000..5cf1a86ada
--- /dev/null
+++ b/benchmark/bm_so_reverse_complement.rb
@@ -0,0 +1,30 @@
+#!/usr/bin/ruby
+# The Great Computer Language Shootout
+# http://shootout.alioth.debian.org/
+#
+# Contributed by Peter Bjarke Olsen
+# Modified by Doug King
+
+seq=Array.new
+
+def revcomp(seq)
+  seq.reverse!.tr!('wsatugcyrkmbdhvnATUGCYRKMBDHVN','WSTAACGRYMKVHDBNTAACGRYMKVHDBN')
+  stringlen=seq.length
+  0.step(stringlen-1,60) {|x| print seq.slice(x,60) , "\n"}
+end
+
+input = open(File.join(File.dirname($0), 'fasta.output.2500000'), 'rb')
+
+while input.gets
+  if $_ =~ />/
+    if seq.length != 0
+      revcomp(seq.join)
+      seq=Array.new
+    end
+    puts $_
+  else
+    $_.sub(/\n/,'')
+    seq.push $_
+  end
+end
+revcomp(seq.join)
diff --git a/benchmark/make_fasta_output.rb b/benchmark/make_fasta_output.rb
new file mode 100644
index 0000000000..158d8fd161
--- /dev/null
+++ b/benchmark/make_fasta_output.rb
@@ -0,0 +1,19 @@
+# prepare 'fasta.output'
+
+def prepare_fasta_output n
+  filebase = File.join(File.dirname($0), 'fasta.output')
+  script = File.join(File.dirname($0), 'bm_so_fasta.rb')
+  file = "#{filebase}.#{n}"
+
+  unless FileTest.exist?(file)
+    STDERR.puts "preparing #{file}"
+
+    open(file, 'w'){|f|
+      ARGV[0] = n
+      $stdout = f
+      load script
+      $stdout = STDOUT
+    }
+  end
+end
+
diff --git a/benchmark/prepare_so_k_nucleotide.rb b/benchmark/prepare_so_k_nucleotide.rb
new file mode 100644
index 0000000000..62e0c76fb9
--- /dev/null
+++ b/benchmark/prepare_so_k_nucleotide.rb
@@ -0,0 +1,2 @@
+require File.join(File.dirname(__FILE__), 'make_fasta_output')
+prepare_fasta_output(100_000)
diff --git a/benchmark/prepare_so_reverse_complement.rb b/benchmark/prepare_so_reverse_complement.rb
new file mode 100644
index 0000000000..b1cd837626
--- /dev/null
+++ b/benchmark/prepare_so_reverse_complement.rb
@@ -0,0 +1,2 @@
+require File.join(File.dirname(__FILE__), 'make_fasta_output')
+prepare_fasta_output(2_500_000)
-- 
cgit v1.2.1