summaryrefslogtreecommitdiff
path: root/test/bench
diff options
context:
space:
mode:
authorRuss Cox <rsc@golang.org>2010-02-25 16:01:29 -0800
committerRuss Cox <rsc@golang.org>2010-02-25 16:01:29 -0800
commit8cdf7be25e63d466a699950effee449803c15da9 (patch)
treea0a5f67e4a643d3bdadd4e28cee9b0900401b62d /test/bench
parent4b1a1ade492d1c6450e37ffb44a8dde0c84b377b (diff)
downloadgo-8cdf7be25e63d466a699950effee449803c15da9.tar.gz
strings: delete Runes, Bytes
gofmt -w -r 'strings.Bytes(a) -> []byte(a)' src/cmd src/pkg test/bench gofmt -w -r 'strings.Runes(a) -> []int(a)' src/cmd src/pkg test/bench delete unused imports R=r CC=golang-dev http://codereview.appspot.com/224062
Diffstat (limited to 'test/bench')
-rw-r--r--test/bench/chameneosredux.go2
-rw-r--r--test/bench/fasta.go3
-rw-r--r--test/bench/k-nucleotide.go3
-rw-r--r--test/bench/meteor-contest.go2
-rw-r--r--test/bench/regex-dna.go3
5 files changed, 5 insertions, 8 deletions
diff --git a/test/bench/chameneosredux.go b/test/bench/chameneosredux.go
index 5445c4210..2cb144004 100644
--- a/test/bench/chameneosredux.go
+++ b/test/bench/chameneosredux.go
@@ -123,7 +123,7 @@ func pallmall(cols []int) {
fmt.Println(msg)
tot := 0
// wait for all results
- for _ = range (cols) {
+ for _ = range cols {
result := <-ended
tot += result.met
fmt.Printf("%v%v\n", result.met, spell(result.same, true))
diff --git a/test/bench/fasta.go b/test/bench/fasta.go
index 1afb1ffb8..f79ff680f 100644
--- a/test/bench/fasta.go
+++ b/test/bench/fasta.go
@@ -41,7 +41,6 @@ import (
"bufio"
"flag"
"os"
- "strings"
)
var out *bufio.Writer
@@ -161,7 +160,7 @@ func main() {
AccumulateProbabilities(iub)
AccumulateProbabilities(homosapiens)
- alu := strings.Bytes(
+ alu := []byte(
"GGCCGGGCGCGGTGGCTCACGCCTGTAATCCCAGCACTTTGG" +
"GAGGCCGAGGCGGGCGGATCACCTGAGGTCAGGAGTTCGAGA" +
"CCAGCCTGGCCAACATGGTGAAACCCCGTCTCTACTAAAAAT" +
diff --git a/test/bench/k-nucleotide.go b/test/bench/k-nucleotide.go
index a5c7f79bb..b4d4098d0 100644
--- a/test/bench/k-nucleotide.go
+++ b/test/bench/k-nucleotide.go
@@ -42,7 +42,6 @@ import (
"io/ioutil"
"os"
"sort"
- "strings"
)
var in *bufio.Reader
@@ -111,7 +110,7 @@ func print(m map[string]int) {
func main() {
in = bufio.NewReader(os.Stdin)
- three := strings.Bytes(">THREE ")
+ three := []byte(">THREE ")
for {
line, err := in.ReadSlice('\n')
if err != nil {
diff --git a/test/bench/meteor-contest.go b/test/bench/meteor-contest.go
index 163aaa7c4..6660810eb 100644
--- a/test/bench/meteor-contest.go
+++ b/test/bench/meteor-contest.go
@@ -532,7 +532,7 @@ func calc_rows() {
/* Calculate islands while solving the board.
-*/
+ */
func boardHasIslands(cell int8) int8 {
/* Too low on board, don't bother checking */
if cell >= 40 {
diff --git a/test/bench/regex-dna.go b/test/bench/regex-dna.go
index 9d56830b3..22de2c6aa 100644
--- a/test/bench/regex-dna.go
+++ b/test/bench/regex-dna.go
@@ -40,7 +40,6 @@ import (
"io/ioutil"
"os"
"regexp"
- "strings"
)
var variants = []string{
@@ -101,7 +100,7 @@ func main() {
fmt.Printf("%s %d\n", s, countMatches(s, bytes))
}
for _, sub := range substs {
- bytes = regexp.MustCompile(sub.pat).ReplaceAll(bytes, strings.Bytes(sub.repl))
+ bytes = regexp.MustCompile(sub.pat).ReplaceAll(bytes, []byte(sub.repl))
}
fmt.Printf("\n%d\n%d\n%d\n", ilen, clen, len(bytes))
}