diff options
| author | Jeffrey Friedl <jfriedl@regex.info> | 2001-11-11 13:15:18 -0800 |
|---|---|---|
| committer | Jarkko Hietaniemi <jhi@iki.fi> | 2001-11-12 14:50:44 +0000 |
| commit | d1be9408a3c14848d30728674452e191ba5fffaa (patch) | |
| tree | d3171518bc3a517cf0c9ce65b5d8382c995f2fb6 /pod/perlretut.pod | |
| parent | bf0fa0b28861f64af680a3c19765ac8a24e4f2bd (diff) | |
| download | perl-d1be9408a3c14848d30728674452e191ba5fffaa.tar.gz | |
a few typo fixes
Message-Id: <200111120515.fAC5FIc74795@ventrue.corp.yahoo.com>
Patching README.foo instead of pod/perlfoo.pod,
not patching Math::BigInt (Tels will take care of that),
dropping broken hv.c and sv.h patches, patching libnetcfg.PL
and perldoc.PL instead of libnetcfg and perldoc, patching
ext/Digest/MD5/t/files.t since MD5.pm was changed.
p4raw-id: //depot/perl@12954
Diffstat (limited to 'pod/perlretut.pod')
| -rw-r--r-- | pod/perlretut.pod | 2 |
1 files changed, 1 insertions, 1 deletions
diff --git a/pod/perlretut.pod b/pod/perlretut.pod index cc8f5c4c9b..65dfb4782c 100644 --- a/pod/perlretut.pod +++ b/pod/perlretut.pod @@ -1415,7 +1415,7 @@ naive regexp $dna = "ATCGTTGAATGCAAATGACATGAC"; $dna =~ /TGA/; -doesn't work; it may match an C<TGA>, but there is no guarantee that +doesn't work; it may match a C<TGA>, but there is no guarantee that the match is aligned with codon boundaries, e.g., the substring S<C<GTT GAA> > gives a match. A better solution is |